Introduction

In recent years, the aquaculture industry has been developing rapidly, but the drug residues caused by the use of antibiotics not only jeopardize food safety, but also the emergence of drug resistance affects the growth and immunity of aquatic animals. Therefore, the development of new anti-disease drugs has become an urgent problem for aquaculture. Common carp (Cyprinus carpio) is widely distributed in eastern Asia and has been introduced to many parts of the world as a farmed species, and is one of the major freshwater farmed fish in China.

Black soldier fly has high protein content, balanced amino acid composition, and high unsaturated fatty acid content, which makes it an ideal substitute for fish meal,1 and the feeding is simple and environmentally friendly.2 Black soldier fly larvae can partially replace fishmeal after simple processing, so it is regarded as one of the ideal substitutes for fishmeal.3 Some studies have shown that black soldier fly can be used as an alternative ingredient of protein or fat sources in feed for different fish species.4–7 Many scholars have used methods such as needling with bacteria fluid, heat induction, pesticide immersion, and starvation feeding with bacteria solution to induce black soldier fly, among which starvation feeding with bacteria is the easiest.8 Aeromonas hydrophila is one of the main pathogenic bacteria in aquatic animals, and the effects of the black soldier fly larvae induced by Aeromonas hydrophila on the growth and immunity of common carp have not been studied yet. Our team’s previous research found that the use of the Aeromonas hydrophila starvation feeding induction method to induce a 72h inhibition effect is better, while the operation is simpler and easier to scale up production (unpublished data).

Antibacterial peptides are important protective factors in the animal’s body, which can resist the attack of bacteria, and are considered to be an ideal alternative to antibiotics.9 However, the high cost of obtaining high-purity antimicrobial peptides restricts their large-scale practical application10By replacing part of the fishmeal with induced black soldier fly larvae, we could formulate functional feeds with anti-disease function and save fishmeal. This method not only fully utilizes the induced antimicrobial peptides and other bioactive substances but also avoids the high cost of isolation and purification and reduces the amount of fishmeal.

In this experiment, Aeromonas hydrophila starvation feeding was used to induce black soldier fly larvae, and the induced black soldier fly larvae were substituted for different ratios of fishmeal in the test diets, and fed to carp for 30 d. Growth performance, immune function, intestinal flora, and expression of four growth and immune-related genes were tested: Growth hormone (GH) gene, Insulin-like growth factor I (IGF-I), Myeloid differentiation factor 88 (MyD88), Toll-like receptor 2 (TLR2), and Toll-like receptor 4 (TLR4) in hepatopancreas. This experiment aims to study the feasibility of induced-treated black soldier fly larvae as functional feed ingredients and low-cost antimicrobial peptide application carriers, providing a theoretical and practical basis for the development of new types of insect protein feed, reducing the dependence on antibiotics in aquaculture, and promoting the green and sustainable development.

Materials and Methods

Experimental diets

The Aeromonas hydrophila strains were kept in the laboratory of the Department of Zoology, Sichuan Agricultural University. Black soldier fly eggs were purchased from Xiangsheng Hermetia illucens Taobao Store, incubated in the Zoology Laboratory of Sichuan Agricultural University, and fed with wheat bran to the fifth instar larvae. Fifth instar larvae were fed with 6.9×107 cells/g Aeromonas hydrophila solution mixed in wheat bran (material-liquid ratio 1:1) for 72 h. Then the larvae were sterilized in a water bath at 80℃ for 1 h, dried and crushed at 50℃ in a drying oven,8 and substituted with 0%, 10%, 20%, and 30% fishmeal to form the feeds for each group, respectively (Table 1). The rest of the diet’s ingredients were purchased from the Animal Nutrition Institute of Sichuan Agricultural University.

Table 1.Composition and nutrients of experimental diets
Items Control
group
10% replacement group 20% replacement group 30% replacement group
Fishmeal 28.50 26.60 24.70 22.85
Soybean meal 20.00 20.00 20.00 20.00
Black soldier fly 0.00 2.85 5.70 8.55
Rapeseed meal 7.00 7.00 7.00 7.00
Flours 15.00 15.00 15.00 15.00
Bran 12.00 12.00 12.00 12.00
Maize 5.00 5.00 5.00 5.00
Vegetable oil 3.80 3.16 2.51 1.86
Alpha starch 5.00 5.00 5.00 5.00
Calcium dihydrogen phosphate 1.00 1.00 1.00 1.00
Choline chloride 50% 0.25 0.25 0.25 0.25
Betaine hydrochloride 98 0.25 0.25 0.25 0.25
Premix* 0.20 0.20 0.20 0.20
Ball mill chaff 2.00 1.69 1.39 1.04
Total 100.00 100.00 100.00 100.00
Proportion of replacement 0.00 10.00% 20.00% 30.00%
Crude protein 35.03 35.02 35.01 35.03
Crude fat 8.00 8.01 8.00 8.00
phosphorus (P) 1.534 1.775 1.977 2.200
Calcium (Ca) 1.885 1.867 1.848 1.832
Lys 2.131 2.122 2.113 2.107
Met 0.728 0.721 0.715 0.709

*Note. This premix in per kg diets supports compositions: VA 400 000 IU, VD 50 000 IU, VC 750 mg, VE 200 mg, VB1 15 mg, VB2 75 mg, VB6 22 mg, VK3 65 mg, Niacin 76 mg, Calcium Pantothenate 350 mg, Biotin 550 mg, Inositol 100 mg, Fe 156 mg, Cu 2.6 mg, Zn 70 mg, Mn 17 mg, Mg 300 mg. Calcium Pantothenate 350 mg, Biotin 550 mg, Inositol 100 mg, Fe 156 mg, Cu 2.6 mg, Zn 70 mg, Mn 17 mg, Mg 300 mg, Co 0.2 mg, I 0.25 mg, Se 0.3 mg.

Experimental animals and feeding management

240 carps in healthy condition and the mean ± SD weight of 48.51 ± 0.47 g were selected and randomly divided into four groups of three replicates of 20 carps each and kept in the smart aquarium of Zoology Laboratory, College of Life Science, Sichuan Agricultural University. The aquarium was sterilized in advance with chlorine dioxide effervescent tablets. The filtration device was cleaned every day, and the water was changed 1/3 every week. During the breeding period, the oxygen pump supplied oxygen uninterruptedly, and the mean ± SD water temperature was 28 ± 2 ℃, the pH was 7.2 ± 0.3, dissolved oxygen was above 6.0 mg/L. Fish were fed regularly twice a day at 4% to 5% of the fish’s body weight. The experimental period was 30 d.

Sample Collection

After the feeding experiment was completed, the carp were fasted for 24 h. The length and weight of the carp in each group were measured. Blood was collected from the tail vein and placed in sodium heparin tubes, centrifuged at 4000 r/min for 10 min at 4℃, and the upper layer of plasma was aspirated and frozen at -20℃. After blood sampling, the carp were dissected, the hepatopancreas, spleen, and kidneys were taken, weighed, and placed at -80℃ for freezing. Intestines were sampled and the contents were squeezed into sterile freezing tubes and frozen at -20°C for storage.

Growth performance

Survival Rate (SR) % = 100 x number of final tails/starting tails
Weight Gain Rate (WGR) % = 100 × (Wt-W0) / W0
Specific Growth Rate (SGR) % /d= 100 × (InWt-InW0) / t
Relative fatness (RF) (g/cm3) = 100 × Wt / L3
Kidney index (KI) % = 100 × Kw / W
Spleen index (SI) % = 100 × Sw / W
Hepatopancreas index (HSI) % = 100 × H w / W
Intestinal length index (ILI) % = 100 × IL / L
Intestinosomatic index (ISI) % = 100 × Iw / W

Where, Wt is the final weight (g), W0 is the initial weight (g), W is the weight(g), Wf denotes the total amount of food ingested (g), L is the body length (cm), t is the feeding time (d), Kw is the kidney weight (g), Sw is the spleen weight, Hw is the hepatopancreas weight, IL is the intestinal length and IW is the intestinal weight.

Measurement of plasma antioxidant and nonspecific immunity indices

Plasma total superoxide dismutase (T-SOD), catalase (CAT), glutathione peroxidase (GSH-PX), total antioxidant capacity (T-AOC), malondialdehyde (MDA) content, lysozyme (LZM), alkaline phosphatase (AKP), and acid phosphatase activity (ACP) were measured by using the kits of Nanjing Jiancheng Bioengineering Institute. The assay procedure was performed in strict accordance with the kit instructions.

Detection of GH, IGF-1, Tlr2, Tlr4 and Myd88 gene expression in the hepatopancreas of carp

Carp hepatopancreas total RNA was extracted using RNAisoTM Plus, and the integrity of the RNA samples was detected by agarose gel electrophoresis, and the concentration and quality of the RNA were determined by ultramicro spectrophotometer. The extracted total RNA was reverse transcribed into cDNA using a reverse transcription kit. Fluorescent quantitative primers were designed according to the obtained carp GH, IGF-I, Tlr2, Tlr4, and Myd88 gene sequences using Primer Express 6.0 software, and the primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. The sequences of primers are shown in Table 2. The cDNA of carp hepatopancreas obtained by reverse transcription was used as the template, the target genes GH, IGF-I, Tlr2, Tlr4, Myd88, and the reference gene β-actin were amplified by real-time fluorescent quantitative PCR, respectively. The samples were repeated 3 times per tissue for each gene, and the reaction system totaled 10 μL: SYBR Premix Ex TaqTM II 3.5 μL; cDNA template 1 μL; upstream and downstream primer mix 0.5 μL; ddH2O 5 μL. Reaction program: 95 ℃ for 2 min, (95 ℃ for 5 s, 55~64 ℃ for 30 s) × 40 cycles. The relative mRNA expression levels of GH, IGF-I, Tlr2, Tlr4, and Myd88 genes were analyzed by using β-actin as the reference gene according to the formula of 2-△△Ct relative quantification.

Table 2.PCR Primers of Real-time fluorescent quantitative assay
Primer number Primer sequence (5'-3')
β-actin-F GAAATTTGCCGCACTGGTTGT
β-actin-R GACCCACGATGGGATGGGAAG
IGF-I-F CCTGGACAAAGCCACTCTTC
IGF-I-R CTCTCAGCCATTCGCCTTAC
GH-F GCTGGTTAGTTTGTTGGTAAAC
GH-R TTTTACTCAGCTGTCTGCGTTTC
TLR2-F AGGATGCTGCGATTCGGTAG
TLR 2-R ATGGGGACGAGCTGCTTTCAA
TLR 4-F GAACTGAATGGGAATAACTGG
TLR 4-R TTCTGACTCGCAATAACCAC
Myd88-F AGTTTGCACTCAGCCTTTGC
Myd88-R GAAAAGATCGGGGGCAGTGCG

Detection of common intestinal flora

In a sterile environment, 0.1 g of carp intestinal contents was weighed into a sterile centrifuge tube, 0.9 mL of sterilized normal saline was added, shook for 15 min and then made a 10-1 dilution; then 10-2, 10-3, 10-4, 10-5, 10-6 times gradient dilution was performed in turn. Each dilution was separately incubated on a specific solid medium (Table 3). Each plate was uniformly coated with 100 μL of diluent and incubated at 37℃ in a constant temperature incubator for 24 h for colony counting, and the number of colonies was expressed as the logarithmic value of the number of bacteria in 1 g of intestinal contents [lg (CFU/g)].

Table 3.Types of medium and culture conditions for the detection of enteric flora
Strain Culture medium Culture condition
Salmonella Bismuth sulfite BS agar 37°C, aerobic, 24h
Escherichia coli Erythromycin Blue Agar (EMB) 37°C, anaerobic, 24h
Bifidobacterium bifidum Bifidobacterium bifidum BBL 37°C, anaerobic, 24h
Lactic acid bacteria Lactobacillus MRS agar 37°C, anaerobic, 24h
Bacillus sp. Bacillus selective 37°C, anaerobic, 24h

Statistical analysis

The results of the experiment were expressed as mean ± standard deviation, and the data were tested for variance and plotted using SPSS 20.0 software and Prism 8.4 software, with P<0.05 indicating a significant difference. First, normality and homogeneity of variances were evaluated using the Shapiro-Wilk and Levene’s tests, respectively. Then, a one-way analysis of variance (ANOVA) was conducted to identify statistically significant differences among the experimental groups. When this analysis showed significance, the Tukey HSD test was employed for individual mean comparison. Whenever normality or homogeneity of variances were not met, appropriate transformations were employed before the ANOVA. The Kruskal-Wallis test was applied if the ANOVA assumptions were still not met.

Results

Effect of partial replacement of fishmeal by black soldier fly larvae on the growth performance of the common carp

The weight gain rate and specific growth rate of carp in the 10% replacement group, 20% replacement group, and 30% replacement group were higher than those in the control group, and the differences between the 20% replacement group and the 30% replacement group and the control group were significant (P<0.05). The hepatopancreatic index of the 10% replacement group was significantly greater than that of the control group and the 20% and 30% replacement groups (P<0.05), and there was no significant difference between the control group, the 20% replacement group, and the 30% replacement group (P>0.05). There was no significant difference between the control, 20% replacement, and 30% replacement groups (P>0.05). There were no significant differences in hypertrophy, intestinal body index, intestinal length index, renal index, and splenic index among the groups (P>0.05) (Table 4).

Table 4.Effects of partial replacement of fishmeal by black soldier fly larvae on the growth performance of the common carp
Project Item Control
group
10%
replacement group
20%
replacement
group
30%
Replacement group
Survival Rate/% 100.00±0.00 100.00±0.00 100.00±0.00 100.00±0.00
Initial Weight/g 50.76±0.04 47.83±0.04 48.00±0.92 47.43±0.06
Final weight/g 85.94±4.49 82.1±4.55 92.95±3.73 92.11±3.89
Weight Gain Rate/% 68.97±9.06b 74.51±9.19ab 98.64±8.96a 94.37±8.26a
Specific Growth Rate/(%/d) 1.55±0.17b 1.65±0.16ab 2.10±0.15a 2.04±0.14a
Relative fatness/(g/cm3) 0.46±0.02 0.46±0.03 0.50±0.01 0.51±0.01
Hepatopancreas index/percent 1.55±0.08b 1.92±0.12a 1.56±0.06b 1.54±0.56b
Intestinosomatic index/% 2.52±0.43 2.69±1.26 2.76±0.48 2.37±0.44
Intestinal length index/% 1.44±0.89 1.14±0.25 1.12±0.15 1.03±0.15
Kidney index/% 0.34±0.14 0.47±0.20 0.31±0.09 0.37±0.10
Spleen index/% 0.20±0.02 0.22±0.02 0.44±0.30 0.19±0.02

Note. Different letters on the shoulder label indicate significant differences (P<0.05), while the same letter on the shoulder label indicates no significant differences (P>0.05).

Effects of partial replacement of fishmeal by black soldier fly larvae on plasma antioxidant and non-specific immune indices in the common carp

There was no significant difference in plasma total antioxidant capacity, superoxide dismutase activity, catalase, and glutathione peroxidase activity among the carp groups (P>0.05). Plasma lysozyme activity gradually increased with the increase of replacement ratio, and the difference between the 30% replacement group and the control group reached a significant level (P<0.05). Acid phosphatase activity in the 10% replacement group was not significantly different from that in the control group (P>0.05) and was significantly higher in the 20% replacement and 30% replacement groups than in the control group (P<0.05). Alkaline phosphatase activity in the 10% replacement group was significantly higher than the control group and the 20% replacement group (P<0.05), and the difference between the 10% replacement group and the 30% replacement group was not significant (P>0.05) (Table 5).

Table 5.Effect of partial replacement of fishmeal by black soldier fly larvae on antioxidant and immune indices of the common carp
Project Item control group 10%
replacement group
20%
replacement
group
30%
replacement
group
T-AOC (mM) 0.77±0.29 0.92±0.20 0.88±0.17 0.93±0.17
T-SOD (U/ml) 34.12±17.43 33.14±14.67 35.20±13.83 38.67±12.38
CAT (U/ml) 12.56±1.61 12.39±1.21 16.96±2.44 14.44±2.64
GSH-PX (IU) 672.82±31.77 651.06±27.07 704.85±12.03 692.51±13.48
MOD (nmol/ml) 22.54±2.04b 34.28±5.11ab 48.43±3.90a 30.61±4.06b
LZM (μg/ml) 1.19±0.27b 1.61±0.07ab 1.79±0.16ab 2.02±0.27a
ACP(U/ml) 161.74±9.72c 178.81±14.69bc 208.23±6.69a 203.36±8.41ab
AKP (U/ml) 12.55±0.16b 15.17±1.13a 10.80±0.42 c 13.90±0.63ab

Note. Different letters on the shoulder label indicate significant differences (P<0.05), while the same letter on the shoulder label indicates no significant differences (P>0.05).

Effects of partial replacement of fishmeal by black soldier fly larvae on the expression of GH, IGF-I, Tlr2, Tlr4, and Myd88 genes in the hepatopancreas of the common carp

The expression of the GH gene in the 10% replacement group was not significantly different from that of the control group (P>0.05), and the expression in the 20% and 30% replacement groups was significantly higher than that of the control and the 10% replacement groups (P<0.05). The expression of the IGF-I gene in the hepatopancreas of the various groups was significantly different from that of the control group (P<0.05) and increased with the increase of the proportion of fishmeal replaced by black soldier fly larvae (Figure 1).

Figure 1
Figure 1.Effect of partial fishmeal replacement by black soldier fly larvae on IGF-I and GH mRNA expression in the common carp

*Note. Different letters indicate significant differences (P<0.05), and the same letters represent non-significant differences (P>0.05). T0 indicates the control group, T1 indicates the 10% replacement group, T2 indicates the 20% replacement group, and T3 indicates the 30% replacement group; the same is applicable to another figure.

The expression of the TLR4 gene in the 10% replacement group was not significantly different from that of the control group (P>0.05), whereas that of the 20% and 30% replacement groups was significantly higher than that of the control group and the 10% replacement group (P<0.05). The expression of TLR2 in the 10%, 20% and 30% replacement groups was significantly higher than that of the control group (P<0.05), but the difference between the 10% replacement and 20% replacement groups was insignificant (P>0.05). Myd88 gene expression in the 10% replacement group was not significantly different from that in the control group (P>0.05), whereas it was significantly higher in the 20%, 30% replacement groups than in the control group and 10% replacement group (P<0.05) (Figure 2).

Figure 2
Figure 2.Effect of partial fishmeal replacement by black soldier fly larvae on the expression of TLR4, TLR2, and Myd88 mRNA in the common carp

Effects of partial replacement of fishmeal by black soldier fly larvae on several common intestinal flora of the common carp

The numbers of E. coli and Salmonella in carp in each experimental group were significantly lower than those in the control group (P<0.05); there was no significant difference in the number of Bacillus sp. in the intestinal tract between groups (P>0.05); the number of Lactic acid bacteria in each experimental group was higher than that of the control group, and with the increase in the proportion of the larvae of the black soldier fly, the number of Lactic acid bacteria showed a tendency to increase incrementally. The number of Bifidobacterium bifidum was significantly higher than that of the control group in all experimental groups (P<0.05) (Table 6).

Table 6.Effect of partial fishmeal replacement by black soldier fly larvae on the intestinal flora of the common carp
Strain (CFU/g) Control
group
10% replacement
group
20%
replacement
group
30% replacement
group
Escherichia coli 5.50±0.4a 3.67±0.05c 4.69±0.08b 4.45±0.46b
Salmonella 5.99±0.86a 3.95±0.13b 0.00 0.00
Bacillus sp. 4.72±0.57 4.76±0.45 4.68±0.44 5.00±1.03
Lactic acid bacteria 4.78±0.51 4.93±0.43 5.13±0.66 5.25±0.67
Bifidobacterium 4.62±0.06b 5.89±0.34a 5.76±0.31a 6.00±0.37a

Note. Different letters on the shoulder label indicate significant differences (P<0.05), while the same letter on the shoulder label indicates no significant differences (P>0.05).

Discussion

Effects of partial fishmeal replacement by Aeromonas hydrophila-induced black soldier fly larvae on the immune and antioxidant capacities of the common carp

Shi et al.11 found that feeding live and dried black soldier fly larvae to koi carp as feed substitutes significantly increased the serum alkaline phosphatase activity of koi carp. Sun et al.12 fed black soldier fly to parrot fish (Cichlasoma synspilum × Cichlasoma citrinellum) and found that the serum lysozyme activity of parrot fish was also significantly enhanced. Peng et al.13 added black soldier fly larvae powder in feed to replace part of fishmeal to feed Largemouth bass (Micropterus salmoides), and the serum acid phosphatase activity was significantly higher in the group with 15%~30% replacement. Although the studies involved different fish species (koi, California perch, and blood parrotfish), they all suggested that supplementation of feed with black soldier fly larvae may have positive effects on nonspecific immunocompetence in different fish species. However, the extent and mechanism of these effects may vary due to differences in physiological characteristics between species, and therefore, caution is needed when making inter-species comparisons.

In our experiment, the common carp were fed with Aeromonas hydrophila-induced black soldier fly larvae instead of part of the fishmeal, and the results showed that the highest plasma lysozyme and acid phosphatase activities were found in the group with a replacement ratio of 30%, and reached a significant difference level with the control group (P<0.05), which was similar to the results of the study by Sun et al.12 and Peng et al.13 The experiment further detected the expression levels of carp immune-related genes TLR2, TLR4 and Myd88 mRNA by real-time fluorescence quantitative PCR, and the results showed that the expression of TLR2, TLR4 and Myd88 genes in 30% black soldier fly larvae replacement group was significantly higher than that in control group, and 10% and 20% replacement groups (Figure 2), which was similar to the results of the study conducted by Huang,14 Ali et al.,15 Huang et al.16 The results mentioned above indicated that the replacement of fishmeal by Aeromonas hydrophila-induced black soldier fly larvae significantly enhanced the immunity of carp.

In recent years, researchers have used various ways to induce antimicrobial peptides in insects. Park et al.17 documented black soldier fly larvae induced with S. aureus, Hu et al.18 induced black soldier fly larvae with the addition of vegetable oil and a mixture of bacterial fluids to the diet; Scieuzo et al.19 used capillary tubes impregnated with cell suspensions of Escherichia coli or Aspergillus flavus to induce black soldier fly larvae by puncturing the body surface, and found that all black soldier fly produced antimicrobial peptides. Aeromonas hydrophila is a common harmful bacterium in aquaculture, widely distributed in natural water, and can cause gill rot and red skin disease in fish. Preliminary work in this experiment showed that induction of Aeromonas hydrophila larvae with starvation feeding produced active substances that inhibited the growth of Aeromonas hydrophila, and replacement of fishmeal with Aeromonas hydrophila-induced larvae significantly enhanced the immunity of carp, presumably related to the antimicrobial peptide. The 80 ℃ water bath for 1 hour could completely eliminate Aeromonas hydrophila but still maintain the strong antibacterial activity of the crude antimicrobial peptide extract. The diameter of the antibacterial zone of the crude antimicrobial peptide before the water bath was 1.9150 ± 0.2358 cm, and after the water bath, it was 1.8917 ± 0.2084 cm. The class of the inhibitory substances obtained from this induction needs to be verified by further experiments.

Superoxide dismutase, catalase, glutathione peroxidase, and other antioxidant enzymes constitute the first line of defense against free radicals. Malondialdehyde is related to the degree of lipid peroxidation in the organism, and its level consequently reflects the severity of free radical attack on the organism. The study of Hu20 showed that replacing 30% of fishmeal with black soldier fly meal significantly increased the activities of superoxide dismutase and glutathione peroxidase in the muscle of crucian carp (Carassius auratus), and reduced the malondialdehyde content considerably. Different studies selected different fish species (crucian carp, snakehead mullet, and greater amberjack) as study subjects, and the forms of black soldier fly larvae meal (regular larvae meal, skimmed larvae meal) and substitution ratios varied, which led to differences in the results of the studies. We directly added the induced black soldier fly larvae to the feed, which saved fishmeal and effectively utilized the induced-expressed antimicrobial peptides and other bioactive substances, reduced procedures and costs incurred in the machining process. In this experiment, the antioxidant capacity of carp in the test group had an upward trend compared with that of the control group, but the difference between the groups was not significant, which differed from the results of the above study (Table 5), which may be related to the species of experimental fish, experimental time, feed formulation and replacement ratio, and more experiments are needed to verify this.

Effects of partial fishmeal replacement by Aeromonas hydrophila-induced black soldier fly larvae on the intestinal flora of the common carp

The microbial community in the fish gut plays a crucial role in gut development, nutrient metabolism, and immune regulation. The results of this experiment showed that feeding carp with Aeromonas hydrophila-induced black soldier fly larvae replacing part of the fishmeal significantly decreased the number of E. coli and Salmonella in the intestinal tract, while the number of Lactobacillus and Bifidobacterium increased significantly, indicating that the intestinal flora of carp was optimized (Table 6). These are similar to the findings of Chen et al.,21 Zhong et al.22 Terova et al.23 used black soldier fly larvae meal instead of fishmeal to feed rainbow trout, which improved the diversity of the intestinal microflora of rainbow trout. They all showed that the replacement of fishmeal by black soldier fly larvae had a positive effect on fish intestinal flora, which to some extent reflects the commonality of the effects of black soldier fly larvae on the regulation of fish intestinal flora in different studies. According to this experiment, the number of bifidobacteria in the intestinal tract of carp in the 10%, 20% and 30% replacement groups was significantly higher than that in the control group, and the number of Lactobacillus sp. increased with the replacement ratio of black soldier fly larvae, but the number of E. coli and Salmonella was significantly lower than that in the control group, and Salmonella were not even detected in the 20% and 30% replacement groups, and it was presumed that, after the treatment with the Aeromonas hydrophilus induction, the antimicrobial peptides and other biologically active substances produced by black soldier fly larvae also played an important role.

Effect of partial fishmeal replacement by Aeromonas hydrophila-induced black soldier fly larvae on the growth performance of the common carp

Black soldier fly has high protein content, balanced amino acids, is rich in minerals, good palatability, and is an ideal raw material for replacing fishmeal. The use of black soldier fly larvae meal to replace part of fishmeal in a variety of aquatic animal feeds has achieved better results.24 In this experiment, the use of Aeromonas hydrophila-induced black soldier fly larvae meal to replace 10%, 20% and 30% of fishmeal in feeding the common carp significantly improved the growth performance of carp, which was similar to the results of Xu et al.,25 Ma et al.,26 and Cui et al.4 Wang GuoXia et al.27 found that 5% dried black soldier fly powder could be used as a substitute for squid paste in the feed of hybrid snakeheads with growth-promoting effects. They all showed that the positive effects of fishmeal replacement by black soldier fly larvae on fish growth performance are, to some extent, common across species. The results of Xiao et al.,28 Abdel-Tawwab et al.,29 and Tippayadara et al.30 showed that the use of black soldier fly larvae to replace part of the fish meal had no significant effect on the growth performance of aquatic animals, which was different from the results of our experiment. A combination of factors may influence the differences between these studies and the results of this experiment. Different species have different growth cycles and differences in the efficiency of nutrient absorption and utilization; in addition, different feeding environments in different studies may have interfered with the growth performance of aquatic animals, thus masking the positive effects of fishmeal replacement by black soldier fly larvae. This fully reflects the complexity of interspecific comparisons. The reason may be that the present experiment used Aeromonas hydrophila-induced treatment of black soldier fly larvae, which produced antibacterial peptides and other biologically active substances to optimize the intestinal microflora and improve the intestinal environment, which may have had a facilitating effect on the digestion and absorption of nutrients. Using real-time fluorescence quantitative PCR to detect the expression levels of GH and IGF-I mRNA in the common carp, the results showed that the expression of carp in the 20% and 30% replacement groups was higher than that of the control group (Figure 1), which further confirmed that replacing part of the fishmeal with induced black soldier fly larvae could promote the growth of the common carp.


Acknowledgments

We sincerely appreciate the experimental site provided by Sichuan Agricultural University and the part of the project testing support provided by Jiangxi Academy of Agricultural Sciences.

Authors’ Contribution

Conceptualization: Anxiang Wen (Lead), Maoyuan Zhou, Shiqi Yan, Junli Liu, Aixi Yang; Data curation: Anxiang Wen, Shiqi Yan, Junli Liu, Jingran Cheng, Mingzhu Zhang, Junfeng Su; Formal Analysis: Anxiang Wen (Lead); Funding acquisition: Anxiang Wen, Siming Li; Methodology: Anxiang Wen (Lead); Project administration: Anxiang Wen;

Supervision: Anxiang Wen (Lead), Siming Li; Writing-original draft: Shiqi Yan, Junli Liu; Writing-review & editing: Shiqi Yan, Junli Liu, Chenghao Li, Anxiang Wen.

Competing of Interest – COPE

The authors of this article declare that they have no competing interests.

Ethical Conduct Approval – IACUC

All black soldier flies and carps followed the guidelines for the care and use of animals for scientific purposes established by the Institutional Animal Care and Use Committee (IACUC) of Sichuan Agricultural University.

All authors and institutions have confirmed this manuscript for publication.

Data Availability Statement

All are available upon reasonable request.